Vectors

Vector Sequence Plasmid Replicon Reporter gene Marker Maps
pOT1+ pBBRMCS5 gfpUV Gent pOT1
pOT2+ pBBRMCS5 gfpUV Gent pOT2
pRU1097+ pBBRMCS5 gfpmut3.1 Gent pRU1097
pRU1098+ pBBRMCS5 gfpmut3.1(LAA) Gent pRU1098
pRU1099+ pBBRMCS5 gfpmut3.1(AAV) Gent pRU1099
pRU1100+ pBBRMCS5 gfpmut3.1(LVA) Gent pRU1100
pRU1101+ pBBRMCS5 gfpmut3.1(ASV) Gent pRU1101
pRU1103+ pBBRMCS5 lacZ Gent pRU1103
pRU1105+ pBBRMCS5 dsRedT3 Gent pRU1105
pRU1106+ pBBRMCS5 dsRedT4 Gent pRU1106
pRU1144+ pBBRMCS5 mRFP1 Gent pRU1144
pRU1701+ pBBRMCS5 gfp+ Gent pRU1701
pRU1064+ RP4 gfpUV-gusA Tet pRU1064
pRU1156+ RP4 gusA-gfpmut3.1 Tet pRU1156
pJP2* RP4 gusA Tet pJP2
pJP2neo_gb RP4 pNeo gusA Tet
pLMB51_gb RP4 Tau InduciblegusA (pJP2) Tet
pLMB509_gb pBBRMCS5 Tau Inducible expression (BD) Gent
pIJ11268_gb RP4 luxABCDE Tet
pIJ11282 RP4 pNeo luxABCDE Tet
pLMB449_gb pBBRMCS5 mCherry pTac const, gfp Inducible Gent
pLMB426_gb pBBRMCS5 mCherry Inducible Gent
pLMB447_gb pBBRMCS5 mCherry pTac Const Gent
pLMB617_gb pBBRMCS5 pTac mCherry Regulatable eGFP Kan
pLMB618_gb pBBRMCS5 Regulatable mCherry Kan
pLMB619_gb pBBRMCS5 pTac eGFP Regulatable mCherry Kan

*pJP2 was constructed by Prell et al (2002) Microbiology 148:615-623 and he should be contacted
for further details.All vector sequences are word files in Genebank format. Copy and paste them into Vector Nti, which will read them with all annotations. +These vectors are described in Karunakaran et al  (2005) Microbiology 151:3249-3246 %Described in Tett at al (2012) Env. Appl. Micro 78:7137. Useful sequence/PCR primers include:
pOT forward CGGTTTACAAGCATAAAGC, 
pOT forward far GACCTTTTGAATGACCTTTA
, pOT reverse gfp GAAAATTTGTGCCCATTAAC
Please note they will not work with all vectors, please check before using. KK’s cloning tips are very helpful and available as a powerpoint file (Cloning_tips).

One Response to Vectors

  1. Michael Hynes says:

    Should the last 3 vectors not be listed as pBBR1MCS-2 (if they are Km resistance, which appears to be the case based on sequence).

    Michael

Leave a Reply

Fill in your details below or click an icon to log in:

WordPress.com Logo

You are commenting using your WordPress.com account. Log Out / Change )

Twitter picture

You are commenting using your Twitter account. Log Out / Change )

Facebook photo

You are commenting using your Facebook account. Log Out / Change )

Google+ photo

You are commenting using your Google+ account. Log Out / Change )

Connecting to %s