| Vector Sequence | Plasmid Replicon | Reporter gene | Marker | Maps | |
| pOT1+ | pBBRMCS5 | gfpUV | Gent | pOT1 | |
| pOT2+ | pBBRMCS5 | gfpUV | Gent | pOT2 | |
| pRU1097+ | pBBRMCS5 | gfpmut3.1 | Gent | pRU1097 | |
| pRU1098+ | pBBRMCS5 | gfpmut3.1(LAA) | Gent | pRU1098 | |
| pRU1099+ | pBBRMCS5 | gfpmut3.1(AAV) | Gent | pRU1099 | |
| pRU1100+ | pBBRMCS5 | gfpmut3.1(LVA) | Gent | pRU1100 | |
| pRU1101+ | pBBRMCS5 | gfpmut3.1(ASV) | Gent | pRU1101 | |
| pRU1103+ | pBBRMCS5 | lacZ | Gent | pRU1103 | |
| pRU1105+ | pBBRMCS5 | dsRedT3 | Gent | pRU1105 | |
| pRU1106+ | pBBRMCS5 | dsRedT4 | Gent | pRU1106 | |
| pRU1144+ | pBBRMCS5 | mRFP1 | Gent | pRU1144 | |
| pRU1701+ | pBBRMCS5 | gfp+ | Gent | pRU1701 | |
| pRU1064+ | RP4 | gfpUV-gusA | Tet | pRU1064 | |
| pRU1156+ | RP4 | gusA-gfpmut3.1 | Tet | pRU1156 | |
| pJP2* | RP4 | gusA | Tet | pJP2 | |
| pJP2neo_gb | RP4 | pNeo gusA | Tet | ||
| pLMB51_gb | RP4 | Tau InduciblegusA (pJP2) | Tet | ||
| pLMB509_gb | pBBRMCS5 | Tau Inducible expression (BD) | Gent | ||
| pIJ11268_gb | RP4 | luxABCDE | Tet | ||
| pIJ11282 | RP4 | pNeo luxABCDE | Tet | ||
| pLMB449_gb | pBBRMCS5 | mCherry pTac const, gfp Inducible | Gent | ||
| pLMB426_gb | pBBRMCS5 | mCherry Inducible | Gent | ||
| pLMB447_gb | pBBRMCS5 | mCherry pTac Const | Gent | ||
| pLMB617_gb | pBBRMCS5 | pTac mCherry Regulatable eGFP | Kan | ||
| pLMB618_gb | pBBRMCS5 | Regulatable mCherry | Kan | ||
| pLMB619_gb | pBBRMCS5 | pTac eGFP Regulatable mCherry | Kan |
*pJP2 was constructed by Prell et al (2002) Microbiology 148:615-623 and he should be contacted for further details.All vector sequences are word files in Genebank format. Copy and paste them into Vector Nti, which will read them with all annotations. +These vectors are described in Karunakaran et al (2005) Microbiology 151:3249-3246 %Described in Tett at al (2012) Env. Appl. Micro 78:7137. Useful sequence/PCR primers include: pOT forward CGGTTTACAAGCATAAAGC, pOT forward far GACCTTTTGAATGACCTTTA , pOT reverse gfp GAAAATTTGTGCCCATTAAC Please note they will not work with all vectors, please check before using. KK’s cloning tips are very helpful and available as a powerpoint file (Cloning_tips).
Should the last 3 vectors not be listed as pBBR1MCS-2 (if they are Km resistance, which appears to be the case based on sequence).
Michael